marker chr position (cM) contig A B H x AF fraction contig primer pos assembly primer pos ori position (cM) primer 1 primer 2 t di primer
cb5258 Cb1 0 cb25.NA_213 30 51 1 11 0.37037037 8790 8790 + 0 ATTTAGGACACAGGGCATTT CGAGGTCTTGAAAAATTATAACA ATTTGCCCCCTGAAAATCTTAGTCG
cb14340 Cb1 0.006536 cb25.fpc2695 34 55 0 4 0.382022472 2954 22877 + 0.006536 GAAAAACCAATTTTCTCTCTTTT GAAGGTATTTGGGTGGATTC CTCTCTTTTGAATGAGACAATTCCTTTTTTTAT
cb14278 Cb1 0.006536 cb25.fpc2695 33 56 1 3 0.370786517 61318 81241 + 0.006536 AAAAATAACCCCGAATTCTC CTTCTGAAGACGTGGATTCTT CGATCACGCCAACGGCT
cb9275 Cb1 cb25.fpc0006 33 56 2 2 0.370786517 153452 576594 + CATTCTCCTTTTCGACTAGTTT TTGAGCCATTTTTCATGATT TCGGATAGCTGCGATTGGAG
cb6850 Cb1 0.006536 cb25.fpc0006 31 50 2 10 0.382716049 221276 644418 + 0.006536 CAACTACTGAAGGCCAAAAA CAGGTTGTAGTAGGTTTTGAGTG CAGGATTTCCAGTTAAAATTCTTGAATTT
cb17260 Cb1 0.026947 cb25.fpc4101 36 52 0 5 0.409090909 48696 712823 = 0.026947 ATTTTTGATATTCATTGCCTTTT TTCAAAGTTTTAGAGATTTCTGTG GGCTGAAATCGCTGGAAAAACTG
cb54 Cb1 0.039143 cb25.fpc0091b 36 53 0 4 0.404494382 290184 940969 - 0.039143 GTACTGTACGAACGGGACTAAA GTCATCTGGAGCGACTTCTA CGAACGGGACTAAAAAAAAACCAACAA
cb3500 Cb1 0.057109 cb25.fpc0091b 37 54 0 2 0.406593407 44170 1186983 - 0.057109 CTTCCCCATTTATTTGCTTTA TTAACTTGATCGAACTGATTTTT AGCCTATGCATACAGACAGGAATT
cb15249 Cb1 0.062957 cb25.fpc4321 35 52 0 6 0.402298851 67530 1298683 + 0.062957 ATAACATCAATTGGAGTAGTCGT AATGATTGAAATCTCGTCAAAC TTCCGTTGAATCGTCCATATCCTC
cb16933 Cb1 0.134507 cb25.fpc4321 36 54 0 3 0.4 1495682 2726835 + 0.134507 AACTGTGGTAAAAGTGAAACGTA AAAAAGGCCAAATAGTTACAAAT GGTGCCTTTATAACCCTGCCT
cb1536 Cb1 cb25.fpc3857b 16933 2769735 +
cb1410 Cb1 0.140288 cb25.fpc3857b 38 52 1 2 0.422222222 488182 3240984 + 0.140288 ACTCACAGTCTCATATTGGGATA GCATCTAAATGATGGAAGCTAT GGGATATCAACGCAACTTTACAAGT
cb12446 Cb1 0.140288 cb25.fpc0071c 36 50 0 7 0.418604651 1461429 4750656 = 0.140288 TCTAGCAATGGGTTTAACAGATA ACAGATGCATAGTATCAATCATTC CCAGTATCTACAACAAAGATGACGTC
cb22801 Cb1 0.140288 cb25.fpc0071c 35 54 0 4 0.393258427 1746085 5035312 = 0.140288 TTACTTTGTCCCTATTTTCAATC TGGGTGATATGATCAACTTTATT CGTCAGAAGAGACACAGACACC
cb22789 Cb1 cb25.fpc0071c 1865321 5154548 =
cb7330 Cb1 0.153109 cb25.fpc2887d 33 49 1 10 0.402439024 527729 5773617 + 0.153109 TCTTATCCTTTAACACCTTCTCA AGGATTCTGTTCTGGGATATTAG TTTCTTTTATCTTTTCGTTTTTCTCCTTATTTTACA
cb13312 Cb1 0.153109 cb25.NA_141 38 51 0 4 0.426966292 17438 5899502 + 0.153109 TTTGTTCAGACTCTTCTTCTTCT AATTCGAGTCGTGTTATACTGAG TTCTTCTTTCAAAGTTACAAAAAATCAGAATCAATA
cb2025 Cb1 0.158957 cb25.fpc0053 36 53 0 4 0.404494382 20519 5926235 - 0.158957 AGGTTTTTCGAATACCTCAAGT AAGAATGCATACCCTAACTCC TGGCAGTTTTGTATTCTGCAGGTA
cb1980 Cb1 0.158957 cb25.fpc0053 38 47 0 8 0.447058824 155268 6060984 - 0.158957 AAATCATCATAAAGAGAGATTGAGA TTCATGTTCAATGTTGTTCTGT AGATCCCAATCGGCAAAAAATATT
cb14871 Cb1 0.158957 cb25.fpc4238 35 54 0 4 0.393258427 57872 6791150 - 0.158957 AAACATCAGAAGGTGACTAAAGA ATCCCTCTTTGGAGTTATAAACA AGCCAACAACCCCTATTTTGTGG
cb14869 Cb1 cb25.fpc4238 27 47 0 19 0.364864865 17979 6831043 - CTTAATGTTGTCACCTTCTTTTG TTCTTCTGTCTTTTCATCATTTC TGTGGTATAAAAAGTGTCAAATCGAATTCA
cb14906 Cb1 0.158957 cb25.fpc2887b 36 54 0 3 0.4 60627 6178594 - 0.158957 ATCCGTTTCAAATCTATCTTCTT GAGTAGACCGACACCTTAAAAA TAGATAAAGCCTTTTTTAAGGTGTCGG
cb19142 Cb1 0.158957 cb25.fpc1417 33 54 0 6 0.379310345 223931 6537921 = 0.158957 TATTTAAACGGAATTTTTGTCTG AATTTAGTTTTTCCCTCATCTTT GCCCTCTGCGACAATTATCAATATAA
cb19158 Cb1 0.158957 cb25.fpc1417 39 54 0 0 0.419354839 20500 6741352 = 0.158957 GTGGTCAAGTCATAAATCAAAAA GTGTTGATGTGAGAGTGTTTGTA CATTCGATTGGGGTTGGAATCAC
cb20720 Cb1 0.158957 cb25.fpc2374b 34 53 0 6 0.390804598 69064 6830916 = 0.158957 CCCTAACCTAACTTATTGCTCAT TATCACTCACCTCCTCCATTT CTTCACCACGAAGTAGTTCCCG
cb20696 Cb1 0.158957 cb25.fpc2374b 33 53 2 5 0.38372093 237484 6999336 = 0.158957 CTTTTACTTTTAACTGGCAATTC GGGAGAGAAGATTACTGTAGGAG CAAAATACCGTATACGATCCATGACTATC
cb7159 Cb1 0.164874 cb25.fpc2888a 38 53 0 2 0.417582418 523249 7575175 + 0.164874 AGGAATAAGAAATACCCACTGAC AAGAAAAGAACGGAGATAAAATC TCTTTAATTCTTTGTTGAAGCAAAGAAATATTCC
cb1373 Cb1 0.164874 cb25.fpc2888a 36 53 0 4 0.404494382 540310 7592236 + 0.164874 AATGAGAGAGTAGCTTGGAAAAG AACCTAGTTGCCTCTATTGACTT TGGCTCCTGTGTGGAAAGTAG
cb1182 Cb1 0.176503 cb25.fpc2888a 40 51 0 2 0.43956044 1050363 8102289 + 0.176503 CTTCAGACATTTCAATGATAAGAT AGTCTGTGTGGTCGTGACAT TTTTTTTTTTGCAATTTTCAGTAAAATAAGACTTACC
cb1050 Cb1 0.188131 cb25.fpc2888a 44 47 0 2 0.483516484 1433337 8485263 + 0.188131 CTGATAGATTTCTCGTTTTCATC CGGATATTGGATCTAGAAAGTTA ACTTTCCTCCCCCTATCCATTCA
cb3561 Cb1 0.194266 cb25.fpc2888a 39 46 0 8 0.458823529 1703922 8755848 + 0.194266 GGTAGCTGTGAAGCGTATAGTAG GGATCCGTTAAATCATTCTACA GTATAACAATAAAAGAGATTGGATAATGTAATATGATT
cb7568 Cb1 0.200401 cb25.fpc4171 41 47 0 5 0.465909091 151278 8908640 - 0.200401 ACCGTAACGAAACTAGTAACACA ATGACTAATAGGCCAGGACATA AATCCAGATTTTGAGAAAACTAATTTATTCCTTAC
cb19655 Cb1 0.212306 cb25.fpc2032 39 51 0 3 0.433333333 61028 9050794 = 0.212306 GAAGAACTACAGGTGAGAATCTG ACCTCCATTCTATCCAATACTTT TTGGTTGATCGAATTACTGATGC
cb19689 Cb1 cb25.fpc2032 0 48 41 4 0 209368 9199134 = CAGCTTTGGTTTAGATGAAAGTA TGTAATTGGGTGGTAATAGTTTG GCCATTCCGGATGGCCATT
cb18005 Cb1 0.218224 cb25.fpc3441 39 49 0 5 0.443181818 79178 9480780 + 0.218224 ATTATTTCTTGACAAAACACTGAC AAAAATAGGGAAATCTGACACA CGTTTGGCTACACTGTTTTACACTCT
cb4792 Cb1 cb25.NA_188 48 42 1 2 0.533333333 8818 9697955 =
cb16862 Cb1 0.231382 cb25.fpc4112 37 46 0 10 0.445783133 106413 9832753 - 0.231382 TCTTATTGAGTAACCCCCATAAT CAAATTACTTTGATCTCGATTGT GCAACATAAAAAAGCAAACAAGGAAAAC
cb14997 Cb1 0.31555 cb25.fpc4030b 40 51 0 2 0.43956044 406895 10248380 - 0.31555 ATAAGATTTTCAGCCATTTGTTA CACGACGTTTCTGGAATTAG AAGTCTTAATTGGGACCCGAATTTCG
cb17827 Cb1 0.439254 cb25.fpc2090 48 42 0 3 0.533333333 153829 10478581 + 0.439254 CACAAATTCTGCTTCCTCTG GTTTAGCTGAAGAACTCACCAT TTGACGAGGATGTCAAGCCTG
cb993 Cb1 0.439254 cb25.fpc4140 48 43 2 0 0.527472527 614257 11148190 - 0.439254 AGAAGAAGGGGTAGAAGAGGT TTTTCAAATGTCTAATTGGGTAA GGTTCAGGAGGTACAGTAACATTTTTCA
                                 
cb15136 Cb2 0 cb25.fpc0022b 49 40 0 4 0.550561798 1144429 93397 - 0 CAAATTTTTCGAGAATCAATTAC GGTATATGATGCTCAGGATCTC TTTTTCGAGAATCAATTACATTTCATCATAGC
cb22786 Cb2 0 cb25.fpc0022b 50 43 0 0 0.537634409 791789 446037 - 0 GCTTAAATCACAATCTTCTCAAA GAGCCAAATGTGGTTTATAACT AGCCTTTGTAGTCTTTGGTTTTTCAG
cb22776 Cb2 0 cb25.fpc0022b 48 43 0 2 0.527472527 735086 502740 - 0 GGAGAAACGAGACTTTTTAGACT CTATTCAGGTTTTTCGAGAGAG GAAAAATGTCGAAAAATTCAAAATAGACTTCATC
cb6358 Cb2 cb25.fpc0022b 23 39 0 31 0.370967742 158887 1078939 - CATTTTCAAATTTTCGATTTTC AGGAAATTACAGGTCCTCAACT AATGCAGAAGCGCTGTTTTGAA
cb5083 Cb2 0.023814 cb25.fpc4114 50 42 0 1 0.543478261 101698 1377114 + 0.023814 ATATTCTCGATGAGCTGTGGT GGGGAAGTAGTAATACAAGTCCT CTAAACCAGGAGTCCCTGTTGG
cb18765 Cb2 0.023814 cb25.fpc4168 46 43 0 4 0.516853933 25369 1402483 + 0.023814 GGATTACTGTACATATCTTAGCTTCA GTTGAAATTTTTGGCATCATA ACTGTAATCTTGCTTTCTGCAGC
cb4553 Cb2 0.069598 cb25.fpc4292 44 45 0 4 0.494382022 367026 1935081 - 0.069598 AATCAGATCTAAAGTGTGATCGT AAAAAGCAGGTAGTTATGGGATA CTAATTATCGCAATTCCTGTGCAAGA
cb4572 Cb2 0.075733 cb25.fpc4292 41 44 0 8 0.482352941 290728 1858783 - 0.075733 GAAGAGCTACAAAAATCTCAAAA TTTTAGCTCCTCGTTTTCTTT CGAAAAACTGTGAAAACTGTGAAAAGTAA
cb16788 Cb2 0.081868 cb25.fpc0071a 40 48 3 2 0.454545455 146582 2164970 + 0.081868 TACAGGAATATTCTGGTTCTGTT GGGTTTCTCTTTATGAACTACAA ACATCCAGTTCGATTTCCGGT
cb21859 Cb2 0.106873 cb25.fpc3052a 45 45 0 3 0.5 557429 2560024 - 0.106873 GGGAAGCATTCTTCAGTGTAT TGTATATATGGTAGATACGTGGAAC TGAAGACAGTTTTCCTAGTCTTCTAGTG
cb13137 Cb2 0.112721 cb25.fpc3052a 47 43 0 3 0.522222222 367624 2749829 - 0.112721 CGGTAACTTCTGAAAAAGGAT ATGATTATTGGTACGATCACATT ATTTTTTGCAGTTCTCAAAATATGCATTCT
cb13217 Cb2 cb25.fpc3052a 40 38 0 15 0.512820513 40326 3077127 - CTTTCGATCAAACTGACTGATT AGATGACCCAAAAGATACAGAA CAAAGGAGGGAGTGTTTAACTAGTCA
cb13016 Cb2 0.118782 cb25.fpc0011 44 42 0 7 0.511627907 1070924 3130698 - 0.118782 GCTTTTCCATCTATGCTCAAT ATTCTAACCTTCCTCTAGTGTCC AGAATTCGCATTTTTCAGGAAGAAGAA
cb6254 Cb2 0.130977 cb25.fpc0011 44 45 3 1 0.494382022 636633 3564989 - 0.130977 TGGAATGAATTCTGTGTATTTTT AAAGCTAACGAAACTCTTGAAAC CAAAGTTAGATGTGCAGGACATATAGC
cb6471 Cb2 cb25.fpc0011 108531 4093091 - AACTAACAGGTCCAAGAAGAGAT GGAGATGTGAGGTAAAAGTTAGA TCAAGAGTGCAAAAAAAAACAAATATCCC
cb3415 Cb2 0.181654 cb25.fpc0072 41 47 3 2 0.465909091 334693 4536315 = 0.181654 GTATTTTTGATCGATTTTTCTGA AGTTTTCAGTTCATTCGCTATC CCCTGTACATAGACTGGCTTGT
cb15106 Cb2 0.187642 cb25.fpc2454a 39 48 0 6 0.448275862 57513 4816227 + 0.187642 TTACATTTGAGAAAAAGACACCT TCACCTCCAAGCTAACATTATAC CAAAGCACGAGTCGAATCATTACAA
cb15087 Cb2 0.200142 cb25.fpc2454a 44 45 0 4 0.494382022 291086 5049800 + 0.200142 TGTTGATATTGGACATATTTTGA CTAGATTTGTCTCTGTTCCATTC GCGTAATGTAATGGGGTGTGAAGA
cb4597 Cb2 0.200142 cb25.NA_214 42 45 3 3 0.482758621 6584 5293143 = 0.200142 CCTCCCTTCTTATTTTTACTGTC CGAGATGTTTTCAGATCATTTTA AACTGTTCGACAAACTGAAAATGTTCC
cb22927 Cb2 0.212801 cb25.fpc2888c 42 45 0 6 0.482758621 92662 5398477 = 0.212801 AAGTTATCACATTTGCATTTCTC GATTCCGGTATCTCAATAAAAAT TCTTTTCTCTCGAGAAGAGCAAAATGT
cb23122 Cb2 cb25.fpc2888c 27 26 0 40 0.509433962 448209 5754024 = CAATTAATTCGTTTGACATTTTC ACGTTTTTCGAATACGTTGA AAATTTTGAAATTTCAAAACTTCCGACT
cb6851 Cb2 0.212801 cb25.fpc0058 43 47 0 3 0.477777778 4161763 5800732 - 0.212801 ATTTTGAACTGTTAGCTTCACAT TATATCTCACTGCAATTTTCACC GGTAGGTTATATGGGCTCTTTGCA
cb7109 Cb2 0.224567 cb25.fpc0058 44 47 0 2 0.483516484 3374243 6588252 - 0.224567 AACAACAGAGGATACTCACTTTC AGGCACGTAGATAATGAAAAAT CCCAAAAGAAGAGGCCGGA
cb19956 Cb2 0.230484 cb25.fpc0058 41 47 0 5 0.465909091 3017167 6945328 - 0.230484 CTTTATACCGATTTCAGCATTTA CAAACCATGGAAATTCTCTAAC CCAATGAGAAACAACTTCCTCTCTCATT
cb5445 Cb2 0.236332 cb25.fpc0058 42 47 0 4 0.471910112 2450025 7512470 - 0.236332 TCATTTCTCTCTCTGATTTTCTC TTTCCTTATATCTGGTTTCTTGA TTATCTCTTGGTTTCTTTCTCTTTTCTC
cb5486 Cb2 0.242112 cb25.fpc0058 43 49 0 1 0.467391304 2210356 7752139 - 0.242112 GATCGATCAGTAGGAGTAGAACA GTGAAGGACAGCAGAAACTAATA GATCAGTAGGAGTAGAACATCAAGTGATT
cb492 Cb2 cb25.fpc0058 31 36 0 26 0.462686567 2164444 7798051 - TTTCTTCATTTCTCTGACTCAAT CTGAGAAAAGGTCATCTGAAAC TTTAGGATTTCCATAATCTTGAACAAGTCTTT
cb458 Cb2 cb25.fpc0058 4 41 0 48 0.088888889 2085817 7876678 - AGACAATTGACAAGAAGAAGGT TTATTGTTGAAGACTTTTGATGA AGCTTGGACCGATTGGATTCC
cb16183 Cb2 0.247762 cb25.fpc0058 41 50 0 2 0.450549451 1979871 7982624 - 0.247762 GAGAACGTTCAAGGTTAGTTTTT TATGTAGCCTCGATTCAACTAGA AAGTGAGTATTTCAAGAAAAGAATTTTTAGTGTC
cb16363 Cb2 0.25939 cb25.fpc0058 39 50 0 4 0.438202247 848766 9113729 - 0.25939 AAATACAGTACCTCCATTTTTGA CACAGATATTTTTCGATTGATCT ATAGACCGAATGAAAATTTCAAGCAACA
cb10650 Cb2 0.265842 cb25.fpc0058 37 44 4 8 0.456790123 600197 9362298 - 0.265842 CTAAACTCTCGAACTGTTACCTG CGTATTGTCGGAAATATACACTC TCTGGATGGTATCGTTTGACATGAA
cb10749 Cb2 cb25.fpc0058 12 34 0 47 0.260869565 25890 9936605 - AAAAACATTGAAAAAGTTGAAGA CAGACGAAATATGAGAGGAGATA ATTTTTTACAGACATCTGATAAATCGAATACTGA
cb3563 Cb2 cb25.fpc4206 27 39 1 26 0.409090909 10888 9973383 + TAATTTCAAAAGAGGAAGAGACA TTCAAAAGAAGAACTCAGCTATC AATCTAGATAGGAGCCTAGATAGCTGA
cb3574 Cb2 0.279176 cb25.fpc4206 37 50 0 6 0.425287356 317130 10279625 + 0.279176 ATCTCTACTGCTCACGTATTGAC AACAACAGCTTTTACGATGTTAC AGAAGAAGTCGTTGGTGTGATTCA
cb4337 Cb2 0.285024 cb25.fpc4206 36 54 2 1 0.4 538219 10500714 + 0.285024 TGACTTTTCCTGTTTGATGAG ATTTTCTTATCAGCAAAAATCTG CCAAAGCTTCCCATGTCTCCA
cb4239 Cb2 0.303208 cb25.fpc4206 41 48 0 4 0.460674157 859098 10821593 + 0.303208 AAAACCTAAACTGTCATCTTTGA CTGAATTCTGATTGTGAGACAG AAACTGAATAGTGGGAGGCCC
cb19820 Cb2 0.315257 cb25.fpc4206 42 48 0 3 0.466666667 1572738 11535233 + 0.315257 AAGTTGTGGATTTTGTACATAGC CTGACTCAGAAAATTTATCACCT AGGTATTTCGGAAGTCAAATCTTTATAAAAACG
cb22656 Cb2 0.333441 cb25.fpc4206 41 49 0 3 0.455555556 1599113 11561608 + 0.333441 ACTACAAAATGAAATGGTCTCC GAGAGCATGAAAACTGCATAAT AATGATGGGAATGTCCTGTTTGC
cb22661 Cb2 0.339501 cb25.fpc4206 38 48 1 6 0.441860465 1630196 11592691 + 0.339501 AAAAATTAAAAATTCCAGATCGT TTCAGGATAATAGTGTTGGATGT GCTCTTTGCTCAATGATTCAGAAGACT
cb19271 Cb2 0.373528 cb25.fpc4071 42 45 0 6 0.482758621 79398 11792608 = 0.373528 TCACTATTCTCACTGATCGTAATC ATCATCCATTTTGTTTGAATAAC TGCTTGTGAGTGATAACTAAATAGGTGT
cb4574 Cb2 0.379376 cb25.fpc1402a 46 47 0 0 0.494623656 76340 11935482 + 0.379376 TTTGAAGTTTTTCGTAAAAAGAG AGGGAAAATGGGAAATACTG ACAGTGGAATACAGTATTTCCCATTTTC
cb15583 Cb2 0.404072 cb25.fpc2260 44 43 0 6 0.505747126 675724 12996604 - 0.404072 CCTGAAAGCTTGTATACCGTAA AAAAATGCCTTCACTTCTGAC ATTTCAAAGACGTTATCTACAAGCTAATCC
cb16865 Cb2 0.461278 cb25.fpc4181 43 45 0 5 0.488636364 22726 13107379 - 0.461278 AAAATACAAGAAACAGCTTGAGA GGAAGAATGTATTATTGGTCAAC GCTTGAGAAAAGAGGATTTCGATGTAA
cb14181 Cb2 0.467338 cb25.fpc4055 42 46 0 5 0.477272727 19510 13229622 - 0.467338 GAGATACTGTGACTTGTTGATGA TTTAGATGATTTTTGACCCTTTT CAAAAGCGGCCCAAAAAAGGG
cb21771 Cb2 0.467338 cb25.NA_155 41 48 0 4 0.460674157 15673 13387613 + 0.467338 CCAAGAAGGTAATGAGGAAAT TTTTACATGATTTTCAGTCATTTT GGTAATGAGGAAATGGTGGAGCT
cb13000 Cb2 0.499608 cb25.fpc0305 39 48 0 6 0.448275862 367971 14143104 - 0.499608 CTTCAGATCTCAGAAGATCCAC CGATGTGTCTTATCTCCCTTAC CAGGAAGAGGAGGTCACTGAAC
cb12970 cb25.fpc0305 34 7 0 52 0.829268293 54429 14456646 - CTGGAAAATAAGGTGGAAAAG AGAGCCTGCTCTTCTCAAGT TGGAAAAGCGATATATTGAATGACCC
                                 
cb13311 Cb3 0 cb25.NA_108 41 49 0 3 0.455555556 33731 33731 = 0 AAGGAAGGGATGAAGTATTTTT CAGCTTTCCAAAAGTTTTATTTA TGTTGTGACAAGTCTCTTACCGAC
cb2665 Cb3 0.012346 cb25.fpc4030a 38 47 3 5 0.447058824 196464 244755 = 0.012346 TAAAGTAACTTCATCGGAATCTC ATCAGGGTATACGGTAGCTCTAA AACCAAATTCAAGTCTAGTCAAGGC
cb2958 Cb3 0.06066 cb25.fpc0010a 39 51 0 3 0.433333333 160938 1126515 = 0.06066 ATACTGTAACCGATGGAATTGT AAACTTACCTATCCGAGTCTACG ACAATTTCCATTGCTCATCGTTTGG
cb20769 Cb3 0.06066 cb25.fpc2587 39 47 0 7 0.453488372 604086 1261296 - 0.06066 CATTGCTCATCGTTAGTTCTAGT TCGAAACTGATGTATTCCATATT GAATTGTGATAAGAAGAAGAAGAAAAAGTTT
cb8516 Cb3 cb25.fpc2587 38 53 0 2 0.417582418 77832 1787550 - CAAAATTTCATAACTTGCTTCA GCCAATCGATAATACGACAC AATTCCAAGATTTTGTGCTTAAAATAAAGGAAA
cb5219 Cb3 cb25.fpc2587 33729 1831653 - CTTATGAGGCATTTGAGAAACT CTTTGTTTGTTTTCAACCTAGAG TCGACTCTAGAAAATTCAATTTCGAACTTT
cb20758 Cb3 0.124576 cb25.fpc4153 35 54 0 4 0.393258427 25392 1890774 + 0.124576 AGAGAAACGAATGGCTATGAG ACAGACGACTTCCTTTGTTTT GCTCCACTGGACAGAGGAC
cb8096 Cb3 cb25.NA_093 31 54 5 3 0.364705882 8654 2099967 = ATTCTGAAATTTTTGAGAGTCAG GTCTAGAAAGGTTTGAATTTGACTA CAAAATCAAAGAAAAATCCTGTAAATCCAAAAAAAA
cb19183 Cb3 0.142983 cb25.fpc4341 35 52 4 2 0.402298851 41431 2153163 = 0.142983 TACTTCCCCATTAAACTTCATAA ACTAAAAACATTGATCACCTTGA GCTGCATGGGCGAATTT
cb10042 Cb3 0.149435 cb25.fpc4069b 30 50 0 13 0.375 131996 2379766 - 0.149435 CAGAAAGAAATGACGAGTTAGAG CGATCTTTGTCTGTTCTCAAATA AAATCTGGAGTAATTTGAGTATGAGAAAC
cb10088 Cb3 0.162594 cb25.fpc4069b 35 55 3 0 0.388888889 17305 2494457 - 0.162594 TTATGGGTTATGCACAGTAGTTT TAGAAACCTGATCCCTGTTTT AGTGACGTGGCATGAGAAAAAATC
cb22597 Cb3 0.168374 cb25.fpc2187 33 56 0 4 0.370786517 507265 2699057 - 0.168374 CTGTCTCTGCTGACTTTGTAATC TGTAATCCAAGAACCTTTAAACA ATTGTGTTGTGATGAGCCTAACCC
cb22622 Cb3 0.174509 cb25.fpc2187 35 51 0 7 0.406976744 382569 2823753 - 0.174509 TGTAGGTACTAGCAAACGATTTT AGAGACACAGAAACCGAGTG CCCGTTTCTCTTTTTTGTCCCTT
cb17390 Cb3 0.200156 cb25.fpc0103 29 59 0 5 0.329545455 42174 3248496 + 0.200156 CAGTCTTTTCAATGAATTTATCC GCAGTTGAGAGAGAATGAGAAG TGTTTGGATGGGATACCATCTGAAAA
cb17382 Cb3 0.200156 cb25.fpc0103 29 61 0 3 0.322222222 128468 3334790 + 0.200156 ACTTGATCTTCTAGCTGGTTTCT CACAAAGTTTCAAAATCTCTGAC CGTGGCTGAAAATCCATATTTTGC
cb6119 Cb3 0.200156 cb25.NA_195 30 61 0 2 0.32967033 55997 3455849 + 0.200156 TGATAAAACAGGCGGATAAC TCGCTTTCTCATTTTACTGTACT CCGGGCCGAAAAGAGAAGAAA
cb12087 Cb3 0.217702 cb25.fpc2976 33 58 2 0 0.362637363 117053 3613246 + 0.217702 CGGATGAGTATATTTGACATTTT TAAACACTGTGGTTTTTGGTATT GAACGGAAATTGGAAAACGGACG
cb12098 Cb3 0.217702 cb25.fpc2976 32 54 1 6 0.372093023 268226 3764419 + 0.217702 GCTAACAATGAACCATTCAAC AGCATGATACATATCAGTCAACA AATGTTGATCAGCATAATCCACAGG
cb14039 Cb3 cb25.fpc2976 26 45 0 22 0.366197183 553232 4049425 + TAACTTTTTAGGTTCCAAGGTTC ACATTTTTCCATCCATAATACAA TGGAATGGCATCTTTTAGAGTGAAATAAAG
cb5362 Cb3 0.230202 cb25.fpc2234 30 58 0 5 0.340909091 1385521 4400792 = 0.230202 CTATCCTTCATCTCGAATAAAAA TACAACCTTTTCAAGCACCT AGTGAGAACAAGCGGTGACG
cb10632 Cb3 0.235983 cb25.fpc2234 33 58 0 2 0.362637363 1336003 4450310 = 0.235983 CTGTCTGGACTTACAAAATTGA TGTTCTTCACCAGAAGGAATAC TTGAATTTAGAATTCCTTCTGATTTTCCAGA
cb21075 Cb3 0.235983 cb25.fpc2234 32 56 2 3 0.363636364 964422 4821891 = 0.235983 AGTCAGGGGAAAAACTTATTG CAATTTTCTTCCCACTATCATAA GCATTCGAATTTTGTTTTGTGTATATTATTATG
cb21057 Cb3 0.235983 cb25.fpc2234 33 55 0 5 0.375 920520 4865793 = 0.235983 GTCTCTTCATTTCATACGCTCT AAAAACTGCTGAAGAATAACAAG AAGCTTTGTGCTAGTTTTATGCCGG
cb1538 Cb3 cb25.fpc2234 23 50 0 20 0.315068493 614007 5172306 = ATGAAAATCCCTGTAATTCTTTT TTTGAACACAGTATAAATGGAAAG TTTATCGGTTGACCAATTGGCCT
cb5220 Cb3 0.235983 cb25.fpc2234 31 58 2 2 0.348314607 563519 5222794 = 0.235983 AAAGCTATCTAGAAGGCTCTGTT AGTAATCATCATAACTGGGGTCT TCTCGAATCGACCCGGAGA
cb12108 Cb3 0.242194 cb25.fpc2234 28 57 0 8 0.329411765 492908 5293405 = 0.242194 CTTCAAGACAACTTTTGACCTTA CCATGATGTTTGGAACTTTT AAATATACACCAGTTTAATCCCGACT
cb8776 Cb3 0.248405 cb25.fpc4044a 31 58 0 4 0.348314607 826610 5830255 + 0.248405 TAGAATAAGTGGACTGGATTGAG CCCATTTTTCTGTGCTATCTAA GGAACACGAGGCTGTGTGC
cb8819 Cb3 0.248405 cb25.fpc4044a 30 51 0 12 0.37037037 756833 5900032 + 0.248405 AATTTCATATTATCCCCCTTTT GTATCTCTTTTCCCTCTTCACTC CTGTCTTCCTTCCTCCCCAC
cb1979 Cb3 0.248405 cb25.fpc2203 33 57 0 3 0.366666667 123890 6780755 - 0.248405 CACCAATAAAGTTTAGTACGTGTT AACAAATTGACATCTCACTCAAG TGTGTTTGGAGCATACTCTAAAAAAGAC
cb22040 Cb3 0.248405 cb25.fpc4079 34 56 0 3 0.377777778 46296 6835831 = 0.248405 TCTCATTTGACGGTGAACTT CAAGAATCCATTTCTATCTGAAG GACCTGAAAATATAAGGTGTCTAATGGAAC
cb5262 Cb3 0.268542 cb25.fpc0201 27 55 1 10 0.329268293 305763 8858016 = 0.268542 GTTAATCCAGCTGACTGATTTC GTTGATAGAGCACCTTGAAAATA GAGCTCTCGCCTTCCTATCGAA
cb5359 Cb3 0.268542 cb25.fpc0201 27 51 2 13 0.346153846 557689 9109942 = 0.268542 ATACTGCGTCTTGTTTTCTCTC TGGCTGATTTAGAAACTAGGAG CAGATATATCCAAAGATTTCTGAAGTTATTGAATTTTTA
cb17443 Cb3 0.275439 cb25.fpc4154 28 58 0 7 0.325581395 317176 9577047 - 0.275439 ATCACGATAAGCGACAATTT GATGCTTGAAAAATGAAAAACTA ACGATAAGCGACAATTTTTGGAAAGA
cb22149 Cb3 0.287634 cb25.fpc2193 32 57 0 4 0.359550562 46319 9651907 + 0.287634 AAAAGTGTACTAGCCAATGGTC CTCAGATTGACTCCAAAACTTC AAGAAAGTTTCCAGGGAAGTTTTGG
cb22189 Cb3 0.293415 cb25.fpc2193 32 59 0 2 0.351648352 172770 9778358 + 0.293415 GATTCTTTGATTATTCAGCTCAT CCAATGGACAAGTTAGAAGTAAA TGATTATTCAGCTCATAAAATGAAATTGTTCG
cb22714 Cb3 0.311381 cb25.fpc0002 33 56 0 4 0.370786517 87693 10065378 + 0.311381 AAATCTCAAAATTGGCTTGTC AAGAATATCCCATTTTTCTTGTC TTTTCGAAAATCCTTGAAAAAATGTTCAAGA
cb9140 Cb3 cb25.fpc2887c 18 48 1 26 0.272727273 84567 10365684 + CAACGAAACTATGTTTTTCAAAT GGATGAATTATTAGTCAGGAATG AGCTGCTATTTCGTACCTAAAATCTCA
cb9186 Cb3 0.324202 cb25.fpc2887c 31 53 1 8 0.369047619 302090 10583207 + 0.324202 TAGAAATCGAGCTGGATGAG TAAGAGCTACAGTAACCCAAAAC TGGAAATTTGAGGCGTTTTGGG
cb6448 Cb3 cb25.fpc4224 24 50 0 19 0.324324324 819582 10748375 - CTTATTTTTGGTGCATCTATGTT AGAATAATGATGTCCTGGAAAA AAACTTCAGATGTCTGTATTCTTCATTCC
cb13529 Cb3 0.365321 cb25.fpc4224 37 46 0 10 0.445783133 402325 11165632 - 0.365321 AATTGAAATTTGGGATTTTGA GAATGCTCCAGAAGAAGATG GCGATACTCTACAAACATCGATTTCTTCA
cb10275 Cb3 0.365321 cb25.fpc4010 39 46 0 8 0.458823529 343675 11922627 - 0.365321 CAAGTCGTTCCTACTATGATGAG TCTCGCAATAGAAACATAGTGAT TTCTAGATTTTTCTGTGAAGAAATGAAGGAAT
cb19477 Cb3 0.365321 cb25.NA_132 38 53 0 2 0.417582418 10995 11578952 + 0.365321 GATGAGCTCTTGTTGCATTT GCAAGACGATCTACCATGAG GGGGGTTTTTTCGCTTCTTTTTG
cb23179 Cb3 cb25.fpc4426b 22 35 0 36 0.385964912 350990 11953902 - TCTTATTTTTCAGGTACACTTACG CTTATTGATTTTTCTGACCTCTG GACTATGTCTTATATATGTTTCCCCATAGGG
cb23143 Cb3 0.399348 cb25.fpc4426b 41 48 0 4 0.460674157 135460 12169432 - 0.399348 CCCATTATTCTTGATCTCTTATG AAATGAAAGAAAGGAAGGAGTAG AATTAGAAGGACCTCGTGGGAAAA
cb15337 Cb3 0.405062 cb25.fpc4013 41 50 1 1 0.450549451 172346 12477238 = 0.405062 ATCCACGTAGTGATGAGACTG TACAACCAATGGGAGTACTGTAG GAGAATAAAGCAGTTTTAGATTTGAAATACATTTAAGA
cb15330 Cb3 0.410649 cb25.fpc4013 42 51 0 0 0.451612903 220159 12525051 = 0.410649 CTACCAGAGCATCCTCGTATT TTTGGGGTGTTTTACACATATT GGGCAGCCGAACAAAAACTTT
cb12100 Cb3 0.416938 cb25.NA_102 42 39 0 12 0.518518519 9372 12581101 = 0.416938 TTATAATTTTTCCAGTTCCCAGT ACATTTTTACAGTAGGCACTTTC CGTAGAGAAATCTGAGAACTCATGGA
cb12106 Cb3 cb25.NA_102 11 10 0 72 0.523809524 51898 12623627 = TTCAATTCTAAATCAGGTTGTTT TTGTTTAAGGGGTTCTTGAAT CAGGTGACTAGTAGCTGCAAAAATT
                                 
cb17468 Cb4 0 cb25.fpc0010b 46 42 0 5 0.522727273 382906 382906 = 0 TTTTCAAAAGTTGAACTCAAAAC GTGACAAGTTATCTCTTCGATTG CTCTCGAAAATAAATATGTATGTCTGAAATTAAATTGAA
cb15614 Cb4 cb25.fpc3752 41 30 0 22 0.577464789 623199 1135528 + TGATCTTTGATTGTGAGAACATA CTAAGCGTTGACAAAATATTACC GGTTGAAGCTATAAGCAAGAAATGTTTG
cb23135 Cb4 0.019357 cb25.fpc3752 40 42 2 9 0.487804878 1036674 1549003 + 0.019357 AAAAATTGCATACAGACCTACAA CAGAAACTATTTTTCTGGTAAGTG AAAATTCACAAATTAATCGAGATTTCGAAACATA
cb23125 Cb4 0.025647 cb25.fpc3752 46 42 1 4 0.522727273 914522 1426851 + 0.025647 TCTGATAATTTTGAAACATCAGTTA TCACATATCATAAAAACCTAAGTCA TATTTTTCGAAATAAATCACTGTGACCTATTTTTT
cb22832 Cb4 0.050969 cb25.fpc3752 47 40 0 6 0.540229885 1162214 1674543 + 0.050969 AGAATATGCCAATTTCTTCTCA CTAATTCTTGCTGTTTCAACACT AGTTTCTGGAGGAACTTGGAGAAG
cb7331 Cb4 cb25.NA_033 38 35 0 20 0.520547945 14475 1799245 = TTCTTAAAGTGGGATGAACAAT TGAAAGACCTATTTCAGTCAAAA GAAATTCGCTCTAAATTGTCTTGAAACAAG
cb8845 Cb4 cb25.fpc4250 36 36 5 16 0.5 114972 1924859 + TATTTAGCTCGTAAGTCGAGAAA ACTTCTAAACGTTAACAGCAGAC CCACTGGAATGTCGAAAATTGAATTT
cb8821 Cb4 0.078753 cb25.fpc4250 45 39 0 9 0.535714286 483031 2292918 + 0.078753 AATTTGGATGAACTGAAGTATTG CCTTTTTGAAATAGTGTTTTCTG GTATTGTGATATCTGAATCTTTTATCCACGA
cb8147 Cb4 0.091912 cb25.fpc4118 46 42 0 5 0.522727273 107121 2507835 + 0.091912 ATTAAATAGCTGCGATAACAGAA TCTTTCTTTTAGGTCGTCACTC GCGATAACAGAAGAAGAACAGTTTTCT
cb8176 Cb4 0.09776 cb25.fpc4118 47 43 0 3 0.522222222 203720 2604434 + 0.09776 TAGGAGTTGGGACCATACCT CATGATCTCAGAGGTAGATTTTT ATTCTATGAGTTTGAAAAAATCTACCTCTGAG
cb17380 Cb4 0.109809 cb25.fpc2501b 43 44 0 6 0.494252874 28128 2727599 = 0.109809 GTCCAACAAGATGTATCGAAAT GAAACTGAGCTAACTTCTTTGAA CTGTGAGAGTGCCAGCTCC
cb16748 Cb4 0.12263 cb25.fpc4382a 44 42 0 7 0.511627907 54942 3047674 - 0.12263 ATAACTGTCTGAGCTTGGTTGT TAGAAATTGATTCCTGGAAACTT GCATTATTAGTGCATTTGAAGTTTCC
cb2961 Cb4 0.129342 cb25.fpc4382c 44 34 0 15 0.564102564 26449 3170149 + 0.129342 GCTTTTCGTAATTTTTCTCAAC CAGCAAATCTTGAATTTCTTTAT ACACCGTTTTTCAGCGAATTT
cb18435 Cb4 0.129342 cb25.fpc3857c 47 37 0 9 0.55952381 148225 3342513 + 0.129342 CTCAACGTCATCGAGAGAGT ACAATGTCCATCAACACCAT ACCGCTTCTACAGATTGCTCAT
cb18346 Cb4 0.135631 cb25.fpc3857c 45 41 0 7 0.523255814 474060 3668348 + 0.135631 AAATTCAGCAACTCAAAAATGT ATTTTCAAAACCGAGGAAAT CAGGAAAAACATATTTCTCAAAGCATGAG
cb3790 Cb4 0.176194 cb25.fpc4260 48 43 0 2 0.527472527 216169 3988970 - 0.176194 AAGGTGTGGAGTATAGAGGCTAC TTTTGACATGTCTATCCATTTTT AACGGAAATTACGGTTTCAAGAAGTTTA
cb3750 Cb4 0.176194 cb25.fpc4260 46 44 0 3 0.511111111 177251 3950052 - 0.176194 CTCAGACAACATCTGAAAACTGT TAAGTCAGGTTTGCCTTATTTTA AAATGACCGTAAACCAGAAAATCTAG
cb10995 Cb4 0.181974 cb25.fpc0143 48 42 1 2 0.533333333 68601 4736793 - 0.181974 CACGAGAGATGTAAGCATTAAAC AGAGATTTAGCTGAACTTCTAATCA TTTCATTCCGCGTGTTTGCTTG
cb10874 Cb4 0.181974 cb25.fpc0143 48 42 0 3 0.533333333 516635 5184827 - 0.181974 GTTGGGTGGCCTTTTATTAG ACAATCTTATCAGTTTTTGGAGA ATTTTTCAGCGTAATCAGCAAGAAAAAAA
cb6423 Cb4 0.181974 cb25.fpc0143 47 41 0 5 0.534090909 590495 5258687 - 0.181974 GTTAGAAGAGAAGAGGGTGCTAA ACTCGAGTTTTTGTGCATATTT ACGGGCGACGTCCTCC
cb14731 Cb4 0.181974 cb25.fpc0143 48 39 1 5 0.551724138 1908905 6577097 - 0.181974 TGTGGATATATAGAAAAAGGGAATA AGAGTGAAGAAAAGGAGAAGAAG AATTTTGAAAATAAGAGGAAGAGAAAGAGCT
cb11584 Cb4 0.181974 cb25.fpc0110 49 42 0 2 0.538461538 79141 7575010 + 0.181974 CGTAGAAATCTGTTAAAGGAGGT AGAACTAGCGTACTTTGTCGTTA CGCCAGCTTGTCAGTCGG
cb14228 Cb4 0.181974 cb25.fpc0110 45 39 0 9 0.535714286 330121 7825990 + 0.181974 GCTTGTTGATGATTTACTCTAGG GCCATAGGATTGTTCTTCTATCT AAATTAAATTAATCCTATTTGAGATCGAAATAATTCAGAA
cb3606 Cb4 0.181974 cb25.fpc0063 44 38 0 11 0.536585366 755988 7484458 = 0.181974 TTGCTTCAAATCTAATTCTTCTG CACTTTCCTTATCAACTCACCTA TGATCACATTGATATACCGTAATCATAGTCAT
cb9283 Cb4 0.181974 cb25.fpc4152 48 40 1 4 0.545454545 94039 7589908 = 0.181974 TTCACCAAACTACATAAAAATCAA CCGTTTCAAATAGTTCTCAAATA ACCAAACTACATAAAAATCAAACTGCTGAA
cb7745 Cb4 0.181974 cb25.fpc4152 41 36 0 16 0.532467532 869349 8365218 = 0.181974 ACTTACATGACAAAACGAAAGAA AAATGGCTTCTCCTAAAACCT TGTCGTGAGAAGGTTTTAGGAGAAG
cb7678 Cb4 cb25.fpc4152 26 35 0 32 0.426229508 998390 8494259 = CACATTTCTTTGGATCACATC CACAATTTCAAAATTTCCTAGAT TAAATTTAATTATGGATCACCATCAAACCTATAGC
cb19161 Cb4 cb25.fpc4152 45 38 8 2 0.542168675 1059542 8555411 = TCTCGATGTCAGATTAGTCACTT AAATTATAAGCTGTTGGGAGAGT TACCAAATTTCAAAAAAATTCATTTTTCAGAGTTTC
cb17206 Cb4 0.181974 cb25.fpc0039 47 41 0 5 0.534090909 1122418 8885396 - 0.181974 ACCACTAACAATAAGTCCCTTTT ACCTTCTCCTAGAATCCTACAAA GGATTCCCAATTTCCGGTGTTCTT
cb13592 Cb4 0.181974 cb25.fpc0039 34 43 0 16 0.441558442 143114 9864700 - 0.181974 CGTCTCATTAATCGTATCAATTT CAGGATACAAATGGAAATACAGT GCCAACGGATAGGCAGTAGAA
cb7750 Cb4 0.188686 cb25.fpc0039 49 43 1 0 0.532608696 4298 10003516 - 0.188686 TTCTTCTGGTTGCTGCTACT CAAGAGGAAGATGGTAGGTG GGCTCGGCTCGATTTCGG
cb3962 Cb4 0.20018 cb25.fpc4069d 49 41 0 3 0.544444444 28189 10036003 - 0.20018 CAAGTACCACTATTTCGTCTTTG TAAGCAATCAGAAATCCAGTATC ACACTTCGACCCCAACTGG
cb4013 Cb4 cb25.fpc4069d 17 29 0 47 0.369565217 264773 10272587 - CCCTTTTATCTTAGACACTTTGA CGACAAAAAGTCACTCTGTATTC TTTACCAAATTTAAATTGAATTTCGAGAATACAGAG
cb16167 Cb4 0.20018 cb25.fpc0081 47 41 0 5 0.534090909 89602 10627851 + 0.20018 GGTCATCTCCTGTATCATCTTT ACTCCTGCTAGTGTCACATAAAA ATGACATCAAGTTAACACAATTACTTTCTCT
cb16182 Cb4 0.20018 cb25.fpc0081 46 37 1 9 0.554216867 314404 10852653 + 0.20018 TCTTTTATTTCTTGTCGTCAGAT CTTCTTCCACTCATGAGCAC TCACACATTTCAGAGTTTTCCGC
cb19643 Cb4 0.20018 cb25.fpc2374a 48 40 1 4 0.545454545 73711 10940284 + 0.20018 TGATCTTCTCACTTTGATGCTAT CTAAACCTCATCTTTTCCATTTC CATACTTTGCCATGGCGGC
cb16852 Cb4 0.20018 cb25.fpc1570 51 39 0 3 0.566666667 39600 10906173 + 0.20018 AATCGACATATGTATCCGTAAAT GAAAGCAGATTAGCAGATAAGG CCAACCGTAATCACCCTTATCTGC
cb16809 Cb4 0.20018 cb25.fpc1570 48 39 0 6 0.551724138 134896 11001469 + 0.20018 CTTGCAGTCCATTATTTGAAG CAAGAAACTCATTCATCAAAATC CACAACGTTACCATCGGCTCT
cb7791 Cb4 0.20018 cb25.fpc1570 49 38 0 6 0.563218391 323566 11190139 + 0.20018 GGTAAAATTTCAAAAATCCAAAC GCAAAAGGATATCAAAACAAAA AAGCGGCTTAGTAGTTTCTAAAAGTTG
cb7823 Cb4 0.20018 cb25.fpc1570 49 41 2 1 0.544444444 360515 11540535 + 0.20018 CTGATAACTTGGAAGAGGAGAA TTGGTGGACTCAAAGTAGAAAT CCAGGTCCCAGTCGCTCA
cb14873 Cb4 0.206028 cb25.fpc4090 48 40 1 4 0.545454545 43051 11829353 + 0.206028 GGGATATGCATCATTATACTCTCT CAAGAGATTTTTCGGAGTTTT CATACTGCAACTCTAAAAAACTCCGAA
cb15906 Cb4 0.230725 cb25.fpc0065a 53 39 0 1 0.576086957 65921 12112923 - 0.230725 CCAAATTTGAGACTTCTAGACC AACGAATAGAATGCATATGTCC AAAATCAGATTTTCAGCCAAAATCC
cb18540 Cb4 0.25512 cb25.fpc4132 52 37 0 4 0.584269663 79287 12310512 + 0.25512 GGATATCTGCCTTTTTGTTAAT CGAAATTTTAGCATAAACTTGAA TCTGCCTTTTTGTTAATTTTTGCATTCTT
cb7589 Cb4 0.289147 cb25.NA_087 47 36 0 10 0.56626506 9562 12479719 + 0.289147 GAGAACAATTGGGGGACTAC TCTTAGTGTACAAACTCTCCAGAA ATTGGTGGAGAGGACAATTCAAGTA
cb22825 Cb4 0.295282 cb25.fpc4217 49 35 0 9 0.583333333 134184 12708917 - 0.295282 CCGCAATACTACTCCATTCTTA TTTTTGGCTCTCAAAACAAT CCCATTTATACATAATTTTTTGATCATTTCCCT
cb16054 Cb4 0.309568 cb25.fpc0107 45 29 2 17 0.608108108 81235 12899865 + 0.309568 CTAGCACTGTCAAAACATCAAA AGAAGTGTAATGGATTCAATGAT GGCAAGCCGGTTGGAATG
cb2090 Cb4 0.375236 cb25.fpc3835 57 35 0 1 0.619565217 788121 12975782 - 0.375236 AGGAGAGAGACTTTTGGATTTT TGTCTTTTCTGCTGTTCTCTTAG CTCAATTGACCACTGGGATCTTCG
cb2293 Cb4 0.39905 cb25.fpc3835 55 36 0 2 0.604395604 550170 13213733 - 0.39905 CCCTAAATAGCTCTAAACTTGTCT TGAGGAAATTCAGCATTTTAAG GAGTTTTGCTTCAAAATTTGACTTCGAG
cb5108 Cb4 0.411551 cb25.fpc3835 47 37 1 8 0.55952381 216740 13547163 - 0.411551 CTAATGTACCGGAAATTAAGTCA ACCATTTCAAAAATCGATAAATA CTTTCTAGTTTTTCATCATTTTTTTCACATAAAAAGA
cb18281 Cb4 0.423897 cb25.fpc2328 51 41 0 1 0.554347826 169747 13823289 = 0.423897 TCCCTATCCATACCAACTTCTA CCATCCAAAAATTCAAACTC TCACTCTTATCAATGCCGACAAATCC
cb18329 Cb4 0.429612 cb25.fpc2328 51 39 0 3 0.566666667 137772 13855264 = 0.429612 TTTAAGCTGACTTTACCGAGTAT GACACTTTCAATTGTCTGTTGTT AACTTTAGAGGAAAAAAAAACTTCCCGA
cb8552 Cb4 0.435529 cb25.fpc4347 52 40 0 1 0.565217391 93553 14086589 = 0.435529 ATTTCCTCCAATAATCTTCAAAT ACTGCTCTCTTCCTTCAGAATA TCAAGCTTCTGAATTCTGACGTCT
cb8535 Cb4 0.441377 cb25.fpc4347 50 38 0 5 0.568181818 123376 14116412 = 0.441377 CTTGGTTACGGTAGCAAAAA TGGACTTCAATTAGAGAAAATGA AAGCACAGTTTAACATTCAAGTTAGGTT
cb10786 Cb4 cb25.fpc4347 20 21 0 52 0.487804878 238612 14231648 = GTGAAGCCATCTACAAAGAACT CAAGATTCAATAAACACAGAACA TGTTTTCGAATTTTAACACTCTGGAAATTTTTTAT
cb23233 Cb4 0.452872 cb25.fpc3052b 51 40 0 2 0.56043956 364909 14290313 = 0.452872 TGATCTTTCAATTGGGGATA CTTCACACATCTCACAAGTCAT CGAATGCTTTTGCAGTCGCG
cb23314 Cb4 0.452872 cb25.fpc3052b 50 40 1 2 0.555555556 96844 14558378 = 0.452872 CACATGTCCTTGTTTCTCTTTAC CGACAGGAGTATCTCTTCAAAA TCGAAGGAACATCATTTCGCTGA
                                 
cb11794 Cb5 cb25.fpc2454b 25 21 0 47 0.543478261 743957 314601 - CATTCATATTATTTCCTTTTTCTGT CTGTTCAAGTTTGGATTCATTAT TAATAACTGCACATTCCACTTCTAAATATG
cb11809 Cb5 0 cb25.fpc2454b 37 43 1 12 0.4625 693208 365350 - 0 CTGAGAACCAAGAGAGACTTTTA AAAGAGGTGTTCGATTTTTAGAT CGAATAAATATTGAGAGTATCTAAAAATCGAACAC
cb11902 Cb5 cb25.fpc2454b 40 33 0 20 0.547945205 251510 807048 - TTTATCAAAACACATTCTCATTG AAAACATCACAAAATAAGGAAAG ACGTGGCATTTGGAAGGAGAA
cb8719 Cb5 0.006536 cb25.fpc2454b 43 43 0 7 0.5 104382 954176 - 0.006536 ATAGATTCCATTCCCGTTGTA TATTTCTCTTTTTCAGCTTCTCC TTGGCCAAGTCGTAAGCTGG
cb8773 Cb5 0.006536 cb25.fpc2454b 43 45 0 5 0.488636364 22148 1036410 - 0.006536 GTCACTATCCTTCCACAATTTAC CAGTTACTTTTATACAGGAACATCA GATAAGAGATTCATAGTAGGATTACCTCTGC
cb13240 Cb5 0.006536 cb25.fpc0024 43 44 0 6 0.494252874 211859 1270417 - 0.006536 AGAAAGATTCCATTGTCAGTGT TAGCCATAGATCAGGTGATTG CTTGCCTCCCCGACGC
cb21107 Cb5 0.018732 cb25.fpc0022a 46 43 0 4 0.516853933 38274 1391856 = 0.018732 CTTCGTGATGGATAGATGAAC GACAAGGACCATATAAAGGAAGT TAGCGTAATCTGACAGTAGTAGTAGTAGGC
cb3578 Cb5 0.018732 cb25.fpc4095 47 43 1 2 0.522222222 70233 1687386 = 0.018732 ACAAAATAAGACCTCAAACTTCA AATCTCGATGGTCAGTTTGATA TCAAACTTCAGTGTGTCATTCAAAACA
cb8459 Cb5 0.025021 cb25.fpc2114 40 42 1 10 0.487804878 137690 1840135 + 0.025021 GCGAGTAAAGTCGATGAAAA CAGATGACCGAATCTAAATAAAG GACACCTTCTGGACAGTGTTCA
cb8380 Cb5 0.031557 cb25.fpc2114 45 43 0 5 0.511363636 290322 1992767 + 0.031557 TTGTTTAATTGTCGATTACCACT TCTCACAAAACCGTCTCTTC GTTGGCTCTCCATCGATATAGAATATCA
cb2439 Cb5 0.031557 cb25.fpc4202 43 40 0 10 0.518072289 28330 2114855 + 0.031557 TCCAAAATCTCTCAGTTTGTTTA CCTTGACCCACTAGAAGAAAA TGGTCAGTTTTTTTTTCTTCTAGTGGG
cb21790 Cb5 0.051168 cb25.fpc4263 48 41 0 4 0.539325843 10457 2339375 = 0.051168 AATTCCGTTTCATTTGATTG AAATATTCAAAACTTCCCAAAAA TGGAGTTGCCGAATTTTTGGG
cb8284 Cb5 0.051168 cb25.fpc4263 50 40 1 2 0.555555556 163206 2492124 = 0.051168 ATGTCAAAAGTTTGCCTAAGAG ACACATCTGTTGTTAGTCGTCTT AACCGGCGATAAAATAAGAGGCC
cb11784 Cb5 0.051168 cb25.fpc4263 47 39 0 7 0.546511628 289680 2618598 = 0.051168 AAAAATGACTCACCATTCAGAC TCCCTCTAGTTACACTTTTCTTTC TGAAGCCGGGAATTTCGCA
cb16713 Cb5 0.057619 cb25.NA_025 46 36 3 8 0.56097561 7776 2645841 = 0.057619 AGAATCCAAGATTTTCCAACA CTTCCTTTTCATGATGTGTGT GTCTTATACCTGCTCAACGAACAAC
cb4604 Cb5 0.063831 cb25.fpc4334b 52 39 0 2 0.571428571 147884 2796477 + 0.063831 CTAATTTCACCCCAAACTCAT TCAAGTGTTTCGTCGTACTTC CTCCAATTTGACCCCAAAAGTTGA
cb8300 Cb5 0.069679 cb25.fpc2310 52 36 3 2 0.590909091 12536 2840911 + 0.069679 AACAACCCCTCAGTAATACCTAC ATAGAAAACCATCCAACCAGT TGTGAAATGGAGCATGTTGAATTT
cb3365 Cb5 0.069679 cb25.fpc2310 48 34 1 10 0.585365854 614905 3443280 + 0.069679 ATCTACCTGAGAACCAAAGAAAG CTGACGAATGAAACTCCTCTAT AGCGACTTCAGAGAATCATAGAGG
cb16783 Cb5 0.082837 cb25.fpc0023 46 35 0 12 0.567901235 405605 3866576 = 0.082837 GAATTCGGATATTCACAGTAGAC GTGGCTGTTCCTCTTCATTAT TGACAATTGTAGATGAGACACCATGTA
cb17749 Cb5 0.096537 cb25.fpc2887a 47 37 0 9 0.55952381 115518 4983521 + 0.096537 GCAGAATCCCTTTTACAGTTT GGTTACTATGATTTCTTCGGAGT TTCACAAATTTATGAAATTTCGCTTGAATTTCT
cb17729 Cb5 0.12357 cb25.fpc2887a 47 40 0 6 0.540229885 203153 5071156 + 0.12357 CTCAACAGACTCTTCTTGGTTC CAGAAAAGTTGTTCCCAAAA ACTCTTCTTGGTTCCTCATACTTTTCTT
cb457 Cb5 0.164133 cb25.fpc2051 43 43 0 7 0.5 35077 5164115 - 0.164133 CTTGTATTCAAGATTGGATTTGT GATTCAGTGGTCACATCTCTACT TGCAGAACTTCTAAAATAGGAAATGTGAAA
cb431 Cb5 0.164133 cb25.fpc2051 43 47 1 2 0.477777778 229053 5358091 - 0.164133 CTGTTGAAAATTTGGATTGAG AATGTCGATTAACTTTAGCAGAA TGATGGTTGTATAAAGAACAAAACGA
cb17810 Cb5 cb25.fpc2051 0 40 41 12 0 374029 5503067 - ATCTTCCAAGGAGTCAGTTTTAT GATGAAAGAAAGGAAAGTCAGAT ACGAGGAAAGTTCAAACTCACTTTTG
cb392 Cb5 0.170669 cb25.fpc4470 38 42 0 13 0.475 1692553 5843689 - 0.170669 TGTTGGTAGGAGCTTTTGTAGTA AGTTCAGACAGTTGATCAAAAAC GAGACTGATCTGAATTTTGATTCATTTCGA
cb59 Cb5 0.177381 cb25.fpc4470 39 44 0 10 0.469879518 87008 7449234 - 0.177381 AAAATACAAAAGTGCACGAATAC GAGCTCATCTAACTAGTCTGTCAA ATCGTCACATCGAACAGTTTCACG
cb2964 Cb5 0.177381 cb25.fpc2220 43 47 0 3 0.477777778 1831925 7619856 - 0.177381 AATCTATTCCAACCTGGTAACAT AATAGGTTGAACTTTTGGGTTAT ATATTTCTAGAAGCAAAAACTATAACCCAA
cb13350 Cb5 0.183441 cb25.fpc2220 38 47 0 8 0.447058824 749802 8701979 - 0.183441 CAACTCGAGGTAAGCAGTGT AGCTCACTCAAGGAAATGTTATT TTGGTGGAGTTGAATGGAATCTCA
cb3127 Cb5 0.183441 cb25.fpc2220 40 46 0 7 0.465116279 989810 8461971 - 0.183441 AATACTTGGAGCAATAAGGACTC TCCTGAAAGATTTTGTTTTACTG CAACCTGGAAAAAGGGAGAAAAGAA
cb3883 Cb5 0.196775 cb25.fpc2220 44 40 0 9 0.523809524 71955 9379826 - 0.196775 CTTCATTTGTCATCTCAAACACT GTGAACGTACAGTTTGAAAGATT TCTGTATATTATTGGCAGCACAATAAAGAAT
cb9955 Cb5 0.209763 cb25.fpc4126 40 47 0 6 0.459770115 73089 9524870 + 0.209763 TTCAAAAACAATAACATCGATTA TCGCAACTGTATTCTCATATTCT TCCTAGAAAACTCAAAAGTGCGAGAATA
cb9693 Cb5 0.216053 cb25.fpc4126 39 44 2 8 0.469879518 1215571 10667352 + 0.216053 GATGTCACAAGGAAAAGATGATA GAAATGCTCAAGTGTTAATCTGT TTGTTTCGATGGTTATGATTATCAATTACCTT
cb22547 Cb5 0.222264 cb25.fpc4126 44 48 0 1 0.47826087 2074470 11526251 + 0.222264 GACTCAAACGCTCAGAAATG ATTTGCTGGTTTAACTTTCTTCT TCCAGGACAACATGTGCTCC
cb19272 Cb5 0.235252 cb25.fpc2501a 41 40 0 12 0.50617284 246462 11846302 + 0.235252 GGATGGAAAGATCAGAGAATC GCGAACTATCTCTTCTGATTG AGATCAGAGAATCGGATGGGCTG
cb19474 Cb5 cb25.fpc0090 44 39 7 3 0.530120482 680169 12564796 + AGAACCACCAGTGCTATCTACTT CAACTACATCACAACACACAGAT GGAGATTTAGATAACCGAAGAGTTGC
cb11419 Cb5 0.370083 cb25.fpc4063 42 37 0 14 0.53164557 177609 13458970 - 0.370083 AGCTCACAGCACACATAAAAT AAATCTCGGTTATTCCCTGTAT CCAGAGAACTTTTCGCTTTGGC
cb11355 Cb5 0.37698 cb25.fpc4063 47 39 0 7 0.546511628 2413 13634166 - 0.37698 TGTCTAATTTTTGATGTGTTTTG TTTTGAAGTGAATTATGACCTAAA TATCATCCTTGCCTTCTCGCTG
cb11774 Cb5 0.37698 cb25.fpc4382b 48 42 0 3 0.533333333 138588 13775167 + 0.37698 TATTCAAAGTTCATGAAAGGTTC TTAGTACGCAACCTGATACTTCT ATACACTTTTTGAAAAATCGACAGATAAGAAGA
cb9089 Cb5 cb25.fpc4031 21 19 0 53 0.525 27086 13862705 = TTTGAAATTTGGTTTTAGATGAA ATAATCGATGGAAAACATAAAAA GATATCCATTCCAGATTCCGTTTCAAA
cb4798 Cb5 0.39659 cb25.NA_073 48 35 0 10 0.578313253 23694 13983881 = 0.39659 TTACGGTATTTTTAGGGTTTAGC CTCCAAAATTTCAAATCTCTACA CTTGAAGACCTGAGGGTCTCTG
cb2086 Cb5 0.446993 cb25.fpc4426a 50 40 0 3 0.555555556 99228 14141600 = 0.446993 TAAATATGTGTCAGTTGTGTCCA ATCAGGTAAATCAGTTGATGAAT AATGTATTTAAAGTGTTCAACTGATAAGAGAACA
cb12896 Cb5 0.460692 cb25.fpc4109 46 32 0 15 0.58974359 317880 14728162 = 0.460692 CGTTAATATATTTGTTGGGGTTA ACAATGCAGTTCAAGGAAGTAT AGACGCAGAGAAGGCAGGC
cb15951 Cb5 0.537768 cb25.fpc0065b 41 44 0 8 0.482352941 5885 14879354 = 0.537768 TAAGTTGGCTCAAAAATATCATC TTATCCCTTTTACTGACCAGAAT GTCGATTTGTACAAATATGGATAGAGATCATATAG
cb12967 Cb5 0.537768 cb25.fpc2888b 45 41 0 7 0.523255814 52739 14997403 = 0.537768 CAAACTTCTCACAATTTGATTTC CGCGAATTTCTAATTTTTCTAAT ACAAATGGAAAGATCAGAAAAATTAAATTAGAAAAATTAG
cb10494 Cb5 0.537768 cb25.fpc0129 45 43 0 5 0.511363636 39993 15246252 = 0.537768 CTGTTTATCGAACTCATCGTAGT AACGAGTTCAACAATGAAGTG ACATACAAAATCGACGAATCGC
cb10621 Cb5 0.537768 cb25.fpc0129 47 43 0 3 0.522222222 260578 15466837 = 0.537768 AGCTAGACTCAATGGTTACAATG AAATAACCCAGATTCCTACCTAA GAGAGCTCAGAAGCAGAGGATG
cb8129 Cb5 0.537768 cb25.fpc0129 46 43 0 4 0.516853933 321013 15527272 = 0.537768 GCTACTTTTCATCTTCTCATTTG ATTTGTGACCTCCTATCTCATC AATGAGCAATATGAAGACAAAAGGATGG
cb11324 Cb5 cb25.fpc0129 28 33 0 32 0.459016393 572376 15778635 = TTTTATGTGATGTGCCTGATAG ATCTGAAATACTTCGAAGATGAA TGAATGGAGCAAAGTGAGCTTCA
cb19816 Cb5 0.549963 cb25.NA_031 46 42 0 5 0.522727273 35194 15987702 = 0.549963 TAAAAAGATGGCTGAAAAATCTA CTTGTTGGACCAGAAAGAGTA GACTAAACGCTATATTTCGTCTTCTAGGA
                  #DIV/0!              
cb12023 CbX 0 cb25.fpc1402c 32 48 0 13 0.4 314510 314510 + 0 AGAGACAGAAGAAGGTGAATTTT AATTTATGATTGCAAAGCTTCTA AATTACTAATTGATAAACAGTGCGACAGG
cb12080 CbX 0.006623 cb25.fpc1402c 42 46 0 5 0.477272727 547737 547737 + 0.006623 GGTTCCCATATACTACCTCTGTT AAAAAGCCACTCTACATCTGAA CCTGCAGGTGTGCTCCA
cb2376 CbX 0.006623 cb25.fpc0071b 44 46 2 1 0.488888889 20779 633095 = 0.006623 GCCCATATCAGTTTATGTTTTT CTACTTTCAGAACGGTGAGTTTA GCTGTGTCGATAACTGTCAAACACA
cb2370 CbX cb25.fpc0071b 23 40 0 30 0.365079365 55709 668025 = AGAATTTCATTTTGTTTTCTGTG ATGTAGATGTTGAGCACTGAGAT CTTGTATCCAACTAAAATGGAAAATCAGTACT
cb16537 CbX 0.006623 cb25.fpc4033 42 48 0 3 0.466666667 2405434 706918 - 0.006623 AAATGAAGCAAGAATACGAGAA AAAACAATATGCTGTTGGATGT TCTTAATGAGATTTCGACCAGAATATTC
cb21766 CbX 0.018251 cb25.fpc4033 40 50 0 3 0.444444444 2114030 998322 - 0.018251 GAGTGTATGAGCAATGTGTGTAA ATCCCTAATCGTTCGATTCTAT GGCCTCATGAACCCCTATATCAG
cb21200 CbX 0.036658 cb25.fpc4033 41 45 0 7 0.476744186 1167196 1945156 - 0.036658 TAAAACAGTCAAAAACTCACACA AAAAACCTCTTGTCCTACATTTC CGACGTTTTCCGGCTTCCATT
cb22278 CbX 0.049646 cb25.fpc4033 40 42 0 11 0.487804878 336732 2775620 - 0.049646 AAGCAGGACTTTTCAGAAATTAT GACTAAACATTTTGCATGGTAGA ACTGCAAGTTCAAATTAGATCTACCATG
cb11789 CbX 0.056449 cb25.fpc4033 42 41 0 10 0.506024096 11457 3100895 - 0.056449 AACAAGTCGGTCCAGTATAGC ATTTTTCAGGTTTCATTGGTC GAGCGGTGCATGGATTACGC
cb18017 CbX 0.056449 cb25.fpc4033 42 33 0 18 0.56 46016 3066336 - 0.056449 TGAAATTGGTAGTGTATTTCAAAG TTCAAGTCTGAGAGCTTTGTG GCTCTTTGAAAATATTTTAATTAATCACAAAGCTC
cb20692 CbX 0.095228 cb25.fpc0045 43 45 0 5 0.488636364 1360851 4473203 + 0.095228 GCTCATTCTTCTTAGCATATTCA GAGAGAAAACAAGAAGATTTCAA TCTGTTTTGACCCAAATTGTGGC
cb7993 CbX 0.095228 cb25.fpc0045 43 46 0 4 0.483146067 1438668 4551020 + 0.095228 AAGGACATTGTTTGATTGTCTAC TGAGAGTGATAGTAGTCGTTTGTC AAGAAGTTGTTATTATCTTCTAAACAAGAAAAAACAA
cb7948 CbX cb25.fpc0045 30 32 0 31 0.483870968 1597437 4709789 + ACGATGCTTACAAAGTAATGAAA TCAATCTTTTCAACTTCGTCTTA GCGGGCTCCGAGGTAATT
cb16676 CbX cb25.fpc4069a 102732 4877626 + ATCAGATCTGTTCTGTGAGTCAT GTGTGGTACTTTTCGACACTAAA TGTTAATATTGTCATTGTTCCACATGAATATTATCA
cb16698 CbX 0.095228 cb25.fpc4069a 37 43 0 13 0.4625 137914 4912808 + 0.095228 ACACTATGTTGAAAGCCAAAA CTTCGATACCTGTTGTTGAGTA TATCGTACCTTATTGCAAATCGGTACT
cb17685 CbX 0.095228 cb25.fpc4069a 41 46 3 3 0.471264368 268929 5043823 + 0.095228 TTTCCAAGCTGTTTTCTTATGTA TCTTGCGATTTTATAAGATTTTC AGACAAAACATTCGAATGTTTATATTGATTCTAGT
cb4151 CbX cb25.fpc4069a 30 20 0 43 0.6 286406 5061300 + CTTGAATTTGTGTTCGTAAATGT CTGATTTTTAATCCATGTAGTTTTT TTCAAATTTAATGCACGAAATTCAGAGTTTT
cb12375 CbX 0.109118 cb25.fpc4069c 38 46 0 9 0.452380952 512135 6249187 + 0.109118 TTTATGCAAATATCAAGATGTGA TTTTTCAGAACAATAGGATATGG AACTGATTTTGTTTCCATTTGGCGA
cb8973 CbX 0.115487 cb25.fpc0083 44 43 3 3 0.505747126 335020 6311273 - 0.115487 AGCGTTTATCAGAGTTTTATAGGT GTATGAGAAGATGAGTTGGATTG TCTTTCCTATTGATACAGTAAGCAGAAAAATT
cb9084 CbX cb25.fpc0083 23 40 0 30 0.365079365 75975 6570318 - TTTTCAAGATTTTCTGATCTATTTC AAGACTTTTTCATCCCAGAAGT AAGAATTGACCTTTCGGTAGAACTGA
cb14359 CbX cb25.fpc4066 34 37 0 22 0.478873239 604463 6800795 - GGAAGTGATGAAGAAAAGTAAGTT GGATGACTGAAGAAAAAGTATGA CCAAGATGTAAGTATAAGTGGTAATCTTCTAAAA
cb14730 CbX 0.121622 cb25.fpc4066 40 45 0 8 0.470588235 148709 7256549 - 0.121622 CGGAATTACGAATTTACAGAAT TTCGAAGAACTATCTCGACACT AACTTGAAAAACTCACCGGATAACC
cb11422 CbX 0.121622 cb25.fpc3857a 43 39 0 11 0.524390244 52423 7457681 + 0.121622 AACCAATAAAATCCTTTCTTAGC ATCCTAATTAATTGTGCTGAGTC CAATCAATTGTCAACTTCACCAAATC
cb2444 CbX 0.121622 cb25.fpc3857a 39 38 0 16 0.506493506 277791 7683049 + 0.121622 ACTCCTTCGCTCAAATACATAC TTTTATTGAAATTCGGGAGAG GCTCAAATACATACAAGCTTGGTTGA
cb2629 CbX 0.128425 cb25.fpc3857a 43 44 0 6 0.494252874 1723013 9128271 + 0.128425 AGACTTTGAGAAAAGAAAAGGAG TACCAGTTATTGCTGATGACTTT AGCGAAGGTTTTGGTTGGCA
cb19797 CbX 0.134342 cb25.fpc3857a 43 45 0 5 0.488636364 2040877 9446135 + 0.134342 ACACCCTATCTTCACCAGAAA AATGGTTAGAGAGAAAACACTAGC GCAGAAAAGAGCGAGCGGG
cb1971 CbX 0.140123 cb25.fpc3857a 44 48 0 1 0.47826087 2141136 9546394 + 0.140123 TGTATGTCTTTATTTTAGTGCTTCA CAAACACATAACATCATCTGAAA GCTTTTCAACTATTGTCAAATTGCGG
cb1800 CbX 0.140123 cb25.fpc3857a 43 43 0 7 0.5 2864297 10269555 + 0.140123 CCACCTACATTCCATCAAAA GTGTGTTGTTCAGAGTTGATGA GGTACAGCTGGACAAGGAACT
cb13128 CbX 0.140123 cb25.fpc3857a 45 41 0 7 0.523255814 3127157 10532415 + 0.140123 CAAGACAGGATATTTGAAACAGT TATACCACGTTTTAAAGAAGACC CAAAAACACTGACTTAGGGTTGCA
cb10631 CbX 0.146745 cb25.fpc3857a 39 41 2 11 0.4875 3830700 11235958 + 0.146745 AAGTTAATGAGGCTAGGAAGAAG ATGTGTTTCATGTGTTAGTTGTG CTCAAGAGGATAAGGGTACTTTCTTTCT
cb11728 CbX 0.146745 cb25.fpc0091a 44 39 1 9 0.530120482 24813 11498821 + 0.146745 TTGCAAGTAGTCTTGATGTCTAA ATCATATTTTCGACCATGTCTC AAACTACCAAGAACCGGTATCTATTTAGC
cb11740 CbX 0.146745 cb25.fpc0091a 42 44 0 7 0.488372093 198246 11672254 + 0.146745 TTTTCTTTCTTCTTTTCCTCTTC ACGGTGTGTGTACACTATTCATT CCTTTAACGGTGTCCATCAATTCG
cb6849 CbX 0.146745 cb25.fpc2397 45 41 0 7 0.523255814 22143 11839393 + 0.146745 ATTGTTTCCGTATAGGAGGATTA TCACATCCTTGTTTATCATTGTA AATATTCTAAGAAACCCGAGAGGATAT
cb16518 CbX 0.166356 cb25.fpc4044b 44 43 2 4 0.505747126 592254 13366213 + 0.166356 CAATTGATAAGTTCGACACTACAC GTGCGGTAATTATATTGAACAGT GAATTCTATAGACTGTTCAATATAATTACCGC
cb14864 CbX 0.19376 cb25.fpc4044b 37 46 0 10 0.445783133 1164853 13938812 + 0.19376 AATGAAGAAATTCAGGTCAATAA CATGATAAAGGGATGTTTCATAC AACATAACCAAAAGACTTGAAATTGAACTG
cb1691 CbX 0.200954 cb25.fpc0003 39 40 3 11 0.493670886 777142 14786644 + 0.200954 ATCACAGTCAAAACGAGTGATAC ATGATACGTGGTCTCTTGATG TGATACCGTAATTTAATATTTCTCGAAGTCTG
cb9641 CbX 0.200954 cb25.fpc0003 45 40 0 8 0.529411765 1043572 15053074 + 0.200954 TGTTGTTGATATTTTTGTATTTTTG CATCCAACAATGTTTATGACAG CAACAATAGCTCAAATGTGAAGAGTATTTTAG
cb9659 CbX 0.207089 cb25.fpc0003 45 44 3 1 0.505617978 1154137 15163639 + 0.207089 ACGGGAAACTAGAAGTATTAACC CTTCTTCAAACATGTTCAGTCTC AACGGTGGTAATTGGAGAATTAGAGA
cb9664 CbX 0.207089 cb25.fpc4023 43 41 0 9 0.511904762 889941 15218939 - 0.207089 TACAATCAATACCAAATCGAGAG GCGGAATTCTATCATCTTTACTT GCACCCACGGTACAAAAATATTGCTA
cb8211 CbX 0.240659 cb25.fpc4023 51 40 0 2 0.56043956 447249 15661631 - 0.240659 AGAAATGCATTGTTCTCTTTTC CTTTTTCTGGAAACTTTAACTCA TTTCAGAAATCTCTTCTCCATTTACAGAATC
cb8248 CbX 0.240659 cb25.fpc4023 46 42 2 3 0.522727273 370286 15738594 - 0.240659 TCACAGTTCTTAATGTTATTGGTC CTCCATTGATTGTGGTTGTT AGAACCTTCAAACTTTTTTAGAAATTTTCTTTGT
cb6150 CbX 0.240659 cb25.fpc4023 44 37 0 12 0.543209877 216977 15891903 - 0.240659 GAACAAAGTTTTTGTAAAATGAAA TTCCATATTTTCAGTTCTGGAC GGACCCTTATTTTTGATTTATAGAAACCTGA
cb6123 CbX cb25.fpc4023 32 29 0 32 0.524590164 55463 16053417 - TGTGGTGGGTTATCAATTAAA TTCTATTTTCAGAATTGGATAAAAC GTTGTCATGGAGCAGTGACTCTAA
cb5748 CbX 0.240659 cb25.fpc4403 45 40 0 8 0.529411765 241495 16350375 = 0.240659 GTGGGGATTGTCATTCTTATT GCTCTGTACTTCTTTCACTTTCA TCCTTTTCTCGTCGTCATCCC
cb6111 CbX 0.240659 cb25.fpc4403 47 40 0 6 0.540229885 599721 16708601 = 0.240659 TTCTGTTTTTCGTTCAAAATTC AAGTCTGCTCGCTTGAGATA ACAATAAAAAATGTTCTTTTGATTATGTTTTTTTTTCAG
cb19019 CbX 0.267332 cb25.fpc0106 37 47 0 9 0.44047619 70131 16794439 + 0.267332 TTGACTCAACGTTCATTCTTAAT GATGTCTATGAGATGCATTTACC GACGACACTGCAGACTAACAGT
cb18839 CbX 0.273783 cb25.fpc0106 40 45 1 7 0.470588235 548851 17273159 + 0.273783 CATTCTGGGAAGAATATCTACAA CAAATCTACTTCTATCGGGATTC CATCTTGTACAAGTTTGGGAAAATCTATCT
cb18742 CbX 0.273783 cb25.fpc0829 38 50 0 5 0.431818182 2837752 17360790 - 0.273783 GAATGTGTACCTCAACTCTGTTT ACCCCTCACCACTCAATATAA CACGTTGCATCAGCCGAC
cb18644 CbX cb25.fpc0829 13 24 0 56 0.351351351 2491516 17707026 - GAAGATTTCTGAGAACTTGAAAA GAGAGACAAAGAAAAATGAATGA CCTTATGAAAAACCGGCTCTAATAATCA
cb7474 CbX 0.318589 cb25.fpc0829 43 37 0 13 0.5375 1610440 18588102 - 0.318589 AACTTGGATGTTAAAATCTGTGA TTTTGGTACCCACCAAATTAT TTGAAGATTTCGAAAATCTCAAAATCTAGAAAATC
cb15550 CbX 0.326108 cb25.fpc0829 37 42 0 14 0.46835443 1161070 19037472 - 0.326108 AAAAGAAGACACCATCTTCTACA GCTTCAACTCGACAATGAAT ACTTACTACAGGAAACGTTGGATGA
cb21042 CbX 0.341035 cb25.fpc0829 36 41 0 16 0.467532468 99777 20098765 - 0.341035 CCGCTTGAGACTCATAGATTAC AAACAGGTGTTCTCTTCCTATTT TCTCAGCTTTCAAATTGCTCACAAG
cb3581 CbX 0.341035 cb25.fpc2334 47 42 2 2 0.528089888 179715 20606332 = 0.341035 AAGTAAGAATTCACCGATTTTTC ACTCGTAATATACGATCAAAATGA CGAATATATAATCAAATCCGTAGTTTATAAAAAGAGAG